Review




Structured Review

Pyrosequencing Inc primers qqs_pyro_f1
Primers Qqs Pyro F1, supplied by Pyrosequencing Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/primers+qqs_pyro_f1/primers+qqs+pyro+f1/pmc03623765-112-29-42
Average 90 stars, based on 1 article reviews
primers qqs_pyro_f1 - by Bioz Stars, 2026-09
90/100 stars

Images

Related Articles

other:

Article Title: Extensive Natural Epigenetic Variation at a De Novo Originated Gene
Article Snippet: To assess the relative contribution of each allele to the population of mRNA in F1 individuals from reciprocal crosses between Col and Kondara, a single pyrosequencing reaction using the primers QQS_pyro_F1 (PCR) - TCAAAATGAGGGTCATATC ATGG , QQS_pyro_R1-biotin (PCR) - ATTGGATACAATGGCCCTATAACT and QQS_pyro_S1 (Pyrosequencing) - GATATTGGGCCTTATCAC was set up on a SNP polymorphic between the QQS parental coding sequences ( ; position +285).



Similar Products

Image Search Results